View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19476_high_13 (Length: 349)
Name: NF19476_high_13
Description: NF19476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19476_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 18 - 339
Target Start/End: Original strand, 42471388 - 42471709
Alignment:
| Q |
18 |
gcatgataatttgtatgtggcagggaaactgtggcaaattactgcaaagaagttagggaattggggttgagaatagaagaatacatatcagagagcttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471388 |
gcatgataatttgtatgtggcagggaaactgtggcaaattactgcaaagaagttagggaattggggttgagaatagaagaatacatatcagagagcttgg |
42471487 |
T |
|
| Q |
118 |
gcctagaaaaagattacttaaggaatgctttaggtgaacaagggcagcacatggcagtgaattactatccaccatgcccacaaccagaacttacttatgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471488 |
gcctagaaaaagattacttaaggaatgctttaggtgaacaagggcagcacatggcagtgaattactatccaccatgcccacaaccagaacttacttatgg |
42471587 |
T |
|
| Q |
218 |
attgccagggcatacagacccaaatgcacttacaattctactccaagatcttcatgttgctggcctacaagtcctcaaagatggcaagtggcttgctatt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471588 |
attgccagggcatacagacccaaatgcacttacaattctactccaagatcttcatgttgctggcctacaagtcctcaaagatggcaagtggcttgctatt |
42471687 |
T |
|
| Q |
318 |
aacccaattcctgatgcctttg |
339 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42471688 |
aacccaattcctgatgcctttg |
42471709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University