View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19476_high_23 (Length: 205)
Name: NF19476_high_23
Description: NF19476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19476_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 14 - 152
Target Start/End: Complemental strand, 9370879 - 9370743
Alignment:
| Q |
14 |
attatactactgtttggatcagatttatcaccgcaagtaaggaaaattgtgaatacgataatataaggaaatgattaggtgaggttgacatggttatttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9370879 |
attatactactgtttggatcagatttatcaccgcaagtaaggaaaattgtgattaagataatataaggaaatgattaggtgaggttgacatggttatttt |
9370780 |
T |
|
| Q |
114 |
cttatatgcagtgcaagtgcaggtttcaaaaccaatgac |
152 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
9370779 |
cttatatgcagtgc--gtgcagggttcaaaaccaatgac |
9370743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 186
Target Start/End: Complemental strand, 9370554 - 9370521
Alignment:
| Q |
153 |
gaaaaacaccaaaatcgtataagaattgcaactt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9370554 |
gaaaaacaccaaaatcgtataagaattgcaactt |
9370521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University