View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19476_low_11 (Length: 395)
Name: NF19476_low_11
Description: NF19476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19476_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 9e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 110 - 343
Target Start/End: Complemental strand, 35093175 - 35092942
Alignment:
| Q |
110 |
gtgttcatatctatgca--tatctctattacgttgctgggttagtttcaatgttttatttaattcccagtgtaattaaagaggtgaggttagtatattgg |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35093175 |
gtgttcatatctatgcaaatatctctattacgttgctgggttagtttcaatgtttta----attcccagtgtaattaaagaggtgaggttagtatattgg |
35093080 |
T |
 |
| Q |
208 |
agagttgaggagaacaagaggttaatgtaaataatgaatttgagatattgaagtgcacttgattgaggttgaatcgattcc--nnnnnnnnngtttaaga |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
35093079 |
agagttgaggagaacaagagcttaatgtaaataatgaatttgagatattgaagtgcacttgattgaggttgaatcgataccttttttttttgttttaaga |
35092980 |
T |
 |
| Q |
306 |
acatcgccaactaatggtgctcttattaacgtatatat |
343 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35092979 |
acatcgccaattaatggtgctcttattaacgtatatat |
35092942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University