View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19476_low_15 (Length: 265)

Name: NF19476_low_15
Description: NF19476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19476_low_15
NF19476_low_15
[»] chr3 (1 HSPs)
chr3 (13-244)||(51414248-51414479)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 51414248 - 51414479
Alignment:
13 agaaggtcatttttatttttagttgtgtaattgggttgacgaggaacgtgaatagtcatcaccaatgcatgacactatgatatatttaataaactgtttc 112  Q
    |||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
51414248 agaaggtcatttttatttttagttgtgtaattaggttgacgagggacgtaaatagtcatcaccaatgcatgacactatgatatatttaataaactgtttc 51414347  T
113 ttctgacatgtttcgaggcaaatcaacacataattgaaacaaattcataagagaatgaaaatgactatgtgtaaataaggaccgatgagtgggcaggaag 212  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
51414348 ttctgacatgtttcgaagcaaatcaacacataattgaaacaaattcataagagaatgaaaatgactatgtgtaaataaggaccgatgagtgagcaggaag 51414447  T
213 gttcaagaagtggatctcaatgggattggtgg 244  Q
    ||||||||||||||||||||||||||||||||    
51414448 gttcaagaagtggatctcaatgggattggtgg 51414479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University