View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19477_high_25 (Length: 238)

Name: NF19477_high_25
Description: NF19477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19477_high_25
NF19477_high_25
[»] chr1 (1 HSPs)
chr1 (12-223)||(35969321-35969531)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 35969531 - 35969321
Alignment:
12 attagaaatagtaggtgttatatgcttaagtcttttcaaggtcttcctcatgagctttaatttggttggtaatgttgccaaactttttctaaccccactg 111  Q
    ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||    
35969531 attagaaatagtaggtgttatatgcttgagtcttttca-ggtcttcctcatgagctttaatttggttaataatgttgccaaactttttctaaccccactg 35969433  T
112 gtgtaaggtgttatatcataaaagaaaactctagcataatagtgttatgataagaattggtgctccatcgcttaatcttccatatttatgtttgccatca 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
35969432 gtgtaaggtgttatatcataaaagaaaactctagcataatagtgttatgatcagaattggtgctccatcgcttaatcttccatatttatgtttgccatca 35969333  T
212 tgtccaaaagat 223  Q
    ||||||||||||    
35969332 tgtccaaaagat 35969321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University