View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19477_high_25 (Length: 238)
Name: NF19477_high_25
Description: NF19477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19477_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 35969531 - 35969321
Alignment:
| Q |
12 |
attagaaatagtaggtgttatatgcttaagtcttttcaaggtcttcctcatgagctttaatttggttggtaatgttgccaaactttttctaaccccactg |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35969531 |
attagaaatagtaggtgttatatgcttgagtcttttca-ggtcttcctcatgagctttaatttggttaataatgttgccaaactttttctaaccccactg |
35969433 |
T |
|
| Q |
112 |
gtgtaaggtgttatatcataaaagaaaactctagcataatagtgttatgataagaattggtgctccatcgcttaatcttccatatttatgtttgccatca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35969432 |
gtgtaaggtgttatatcataaaagaaaactctagcataatagtgttatgatcagaattggtgctccatcgcttaatcttccatatttatgtttgccatca |
35969333 |
T |
|
| Q |
212 |
tgtccaaaagat |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35969332 |
tgtccaaaagat |
35969321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University