View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19477_low_15 (Length: 314)
Name: NF19477_low_15
Description: NF19477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19477_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 17 - 304
Target Start/End: Original strand, 40283308 - 40283582
Alignment:
| Q |
17 |
atcatttgctgcaaccaaaaacattggtgtatatttcttgaaactgctgatcctattgtatggtgaagtgcaggactgaagcattaagagggaatcgttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283308 |
atcatttgctgcaaccaaaaacattggtgtatatttcttgaaactgctgattctattgtatggtgaagtgcaggactgaagcattaagagggaatcg--- |
40283404 |
T |
|
| Q |
117 |
caggatcgttagctccttttttggcgaagtaattaatgtgattttcttatttagttttgctatgagtgaatgatgctacaagagcagtggtcttgtattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283405 |
--------ttagctccttttttggcgaagtaattaatgtgattttcttatttagttttgctatgagtgaatgatgctacaagagcagtggtcttgtattt |
40283496 |
T |
|
| Q |
217 |
aattgcctcatatacttagtcttgtcctggtttgctatgccttgatgatcgttgttggggactttgaggtattgtatgaatgatgatg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283497 |
aattgcctcatatacttagtcttgtcctggtttgctatgccttgatga--gttgttggggactttgaggtattgtatgaatgatgatg |
40283582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University