View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19477_low_28 (Length: 215)

Name: NF19477_low_28
Description: NF19477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19477_low_28
NF19477_low_28
[»] chr3 (1 HSPs)
chr3 (17-203)||(48439301-48439487)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 48439487 - 48439301
Alignment:
17 agttgctttatctttgttctaatttaagagcaagtaatatggatatattaatcaatgggagctgctaatatggttccatttgttaccaagagggtgttta 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||    
48439487 agttgctttatctttgttctaatttaagagcaagtaatatggatatattaatcaatgggagctgctaatatggttccatttgttgccaagagggagttta 48439388  T
117 ttagcaatttaccccagggaggatatagaggcattgatgagatataaaatttaactatattttattgaaactttcttggttcatctc 203  Q
    ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||    
48439387 ttaacaatttaccccagggaggatatagaggcattgatgagatgtaaaatttaactatattttattgaaactttcttggtttatctc 48439301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University