View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19477_low_29 (Length: 214)
Name: NF19477_low_29
Description: NF19477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19477_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 106 - 198
Target Start/End: Complemental strand, 34256575 - 34256483
Alignment:
| Q |
106 |
ctgcaaagtaatctgaaccgcagatcttgttcaaaccaccaatgatatggttgattttggcatcacagaatccaaatccctttaaactcttcc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34256575 |
ctgcaaagtaatctgaaccgcagatcttgttcaaaccaccaatgatatggttgattttggcatcacagaatccaaatccctttaaactcttcc |
34256483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 34256664 - 34256600
Alignment:
| Q |
18 |
gaacatcggcggtggtttgatcaagatggtctggtccatatttcaaactcgtgttttagatttat |
82 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34256664 |
gaacatcggtggtggtttgatcaagatggtctggtccatatttcaaactcgtgttttagatttat |
34256600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University