View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19478_high_4 (Length: 238)
Name: NF19478_high_4
Description: NF19478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19478_high_4 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 13724592 - 13724370
Alignment:
| Q |
16 |
cattggtaatcgtaagattgagtttcttccgtttattaaatatgctgattttcattttgttttcgaatatccaaattgttgagcttaaaatttgcattgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13724592 |
cattggtaatcgtaagattgagtttcttccgtttactaaatatgctgattttcattttgttttcgaatatccaaattgttgagcttaaaatttgcattgt |
13724493 |
T |
 |
| Q |
116 |
caaatcttgatcaatcggtcattgatgtgctgactacgtgaacttaggatattccaaccgcagaaaatcttgatgtattataaaataaagcagcttttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13724492 |
caaatcttgatcaatcggtcattgatttgctgactaagtgaacttaggatattccaaccgcagcgaatcttgatgtattataaaataaagcagcgtttca |
13724393 |
T |
 |
| Q |
216 |
gctgcaaaattatggtctacaaa |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13724392 |
gctgcaaaattatggtctacaaa |
13724370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University