View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19479_low_3 (Length: 266)
Name: NF19479_low_3
Description: NF19479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19479_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 51 - 260
Target Start/End: Complemental strand, 21308010 - 21307801
Alignment:
| Q |
51 |
ggatggttggttaagttgggaagaagttggttcatatcccgtaaatatttaagttcaactttaaccaccaacatcaaaccttattagtagttcaacactc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||| |
|
|
| T |
21308010 |
ggatggttggttaagttgggaagaagttgtttcatatcccgtaaatatttaagttcaactttaaccatcaacatcaaactttattagtagttcaacgctc |
21307911 |
T |
 |
| Q |
151 |
tttaaattttgagatttaattgactttcgcgctcaactcacataaac-tttttatatt-aaaaaagttagaatttaaatctaatgaatgagatgacattt |
248 |
Q |
| |
|
|||||| ||| |||||||||| ||||| |||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||| || | |
|
|
| T |
21307910 |
tttaaactttaagatttaattaacttt--cgctcaactcacataaacttttttatattaaaaaaaattagaatttaaatctaatgaatgagatgatatat |
21307813 |
T |
 |
| Q |
249 |
aattccataatt |
260 |
Q |
| |
|
||| | |||||| |
|
|
| T |
21307812 |
aatccaataatt |
21307801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University