View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19481_low_11 (Length: 227)
Name: NF19481_low_11
Description: NF19481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19481_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 40513702 - 40513587
Alignment:
| Q |
1 |
caagttagcatgctcatctttgggatatttaacaaaacctat--gatcggttcgaaaatatttttaaggaatgatatatggctttgatagttatatacta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40513702 |
caagttagcatgctcatctttgggatatttgacaaaacctatgagatcggttcgaaaatatttttaaggaatgatatat-gctttgatagttatatacta |
40513604 |
T |
|
| Q |
99 |
tgataaaaggatgaaca |
115 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40513603 |
tgataaaaggatgaaca |
40513587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 144 - 222
Target Start/End: Complemental strand, 40513586 - 40513515
Alignment:
| Q |
144 |
atatgattgtagacatctgcttagatattaacctcatcctcatggtgaataaattgaactacatcataaagtggtagtt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40513586 |
atatgattgtagacatctgcttagatattaacc------tcatggtgaataaattgaactacatca-aaagtggtagtt |
40513515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University