View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19481_low_11 (Length: 227)

Name: NF19481_low_11
Description: NF19481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19481_low_11
NF19481_low_11
[»] chr8 (2 HSPs)
chr8 (1-115)||(40513587-40513702)
chr8 (144-222)||(40513515-40513586)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 40513702 - 40513587
Alignment:
1 caagttagcatgctcatctttgggatatttaacaaaacctat--gatcggttcgaaaatatttttaaggaatgatatatggctttgatagttatatacta 98  Q
    |||||||||||||||||||||||||||||| |||||||||||  ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
40513702 caagttagcatgctcatctttgggatatttgacaaaacctatgagatcggttcgaaaatatttttaaggaatgatatat-gctttgatagttatatacta 40513604  T
99 tgataaaaggatgaaca 115  Q
    |||||||||||||||||    
40513603 tgataaaaggatgaaca 40513587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 144 - 222
Target Start/End: Complemental strand, 40513586 - 40513515
Alignment:
144 atatgattgtagacatctgcttagatattaacctcatcctcatggtgaataaattgaactacatcataaagtggtagtt 222  Q
    |||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||| ||||||||||||    
40513586 atatgattgtagacatctgcttagatattaacc------tcatggtgaataaattgaactacatca-aaagtggtagtt 40513515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University