View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19481_low_4 (Length: 333)
Name: NF19481_low_4
Description: NF19481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19481_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 36834077 - 36834391
Alignment:
| Q |
18 |
actaaaatgtgtaatatttgttatttgttttattcttgtgttggttttttaccgttcaacactttgttcatacaccattatggccaattttatacatgtg |
117 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36834077 |
actaaaatgtgtaatatttgtcatttattttattcttgtgttggttttttaccgttcaacactttgttcatacaccattattgccaattttatacatgtg |
36834176 |
T |
|
| Q |
118 |
aaataaatttgtatcgcataaaacactagagatccctccctcgtttgaaccaccacgcttgagtttgatcatttacatcttctatttctcaaccgatttg |
217 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36834177 |
aaataaatttgtatcgcataacacactaaagatccctccctcgtttcaaccaccacgattgagtttgatcatttacatcttctatttctcaaccgatttg |
36834276 |
T |
|
| Q |
218 |
tactatgaatcaatgatttttaaaccttcaatttgtggtacgacacaatcttcaacttccatctctaagctagaaatgcttctctttttggtaaaattgt |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36834277 |
tactatggatcaatgatttttaaaccttcaatttgtggtacgacacaatcttcaacttccatctctaagctagaaatgcttctctttttggtaaaattgt |
36834376 |
T |
|
| Q |
318 |
attttatatgctacg |
332 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36834377 |
attttatatgctacg |
36834391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University