View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19481_low_6 (Length: 288)
Name: NF19481_low_6
Description: NF19481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19481_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 270
Target Start/End: Original strand, 26608454 - 26608706
Alignment:
| Q |
16 |
atcaccaacttaaagaaaaataaataaatgacaaatctaannnnnnngttgttaagaaaccgtaaaaataattgtctttccataaaacttcttgctgcga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26608454 |
atcaccaacttaaagaaaaataaataaatgacaaatcttatttttt--ttgttaagaaaccgtaaaaataattgtctttccataaaacttcttactgcga |
26608551 |
T |
|
| Q |
116 |
taagaatgaatttggtaaagatcatgtcaattgaacacaaatccacacttcactttttggttgatcagccatagttgagtaagagtcattattcccttat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608552 |
taagaatgaatttggtaaagatcatgtcgattggacacaaattcacacttcactttttggttgatcagccatagttgagtaagagtcattattcccttat |
26608651 |
T |
|
| Q |
216 |
attgagacaagtcaagttcaaacaagtgcagtgagtgctctttgtcgtgtgctag |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608652 |
attgagacaagtcaagttcaaacaagtgcagtgagtgctctttgtcgtgtgctag |
26608706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 26595012 - 26595067
Alignment:
| Q |
125 |
atttggtaaagatcatgtcaattgaacacaaatccacacttcactttttggttgat |
180 |
Q |
| |
|
||||||||||||||||||| || || ||||||| ||||||| ||||||| |||||| |
|
|
| T |
26595012 |
atttggtaaagatcatgtcgatggagcacaaattcacacttaacttttttgttgat |
26595067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University