View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19482_high_13 (Length: 218)
Name: NF19482_high_13
Description: NF19482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19482_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 31277610 - 31277420
Alignment:
| Q |
18 |
agatatcgcaacaggactcgacgatttgtttcaggggagtggtaaatccaattagttaccacaatagca--atactataatatggtgtagcaatattata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31277610 |
agatatcgcaacaggactcgacgatttgtttcaggggagtggtaaatccaattagttaccacaatagcacaatactataatatggtgtagcaatattata |
31277511 |
T |
|
| Q |
116 |
atatggtgttatgaaggtagctatgactaaatgtaactactcttgcaacgagtatgctcacaattattattcttagacctatatggatatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31277510 |
atatggtgttatgaaggtagctatgactaaatgtaactactcttgcaacgagtatgctcacaattattattcttagacctatatggatatt |
31277420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University