View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19482_high_13 (Length: 218)

Name: NF19482_high_13
Description: NF19482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19482_high_13
NF19482_high_13
[»] chr5 (1 HSPs)
chr5 (18-206)||(31277420-31277610)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 31277610 - 31277420
Alignment:
18 agatatcgcaacaggactcgacgatttgtttcaggggagtggtaaatccaattagttaccacaatagca--atactataatatggtgtagcaatattata 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
31277610 agatatcgcaacaggactcgacgatttgtttcaggggagtggtaaatccaattagttaccacaatagcacaatactataatatggtgtagcaatattata 31277511  T
116 atatggtgttatgaaggtagctatgactaaatgtaactactcttgcaacgagtatgctcacaattattattcttagacctatatggatatt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31277510 atatggtgttatgaaggtagctatgactaaatgtaactactcttgcaacgagtatgctcacaattattattcttagacctatatggatatt 31277420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University