View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_high_17 (Length: 375)
Name: NF19485_high_17
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 7e-68; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 184 - 365
Target Start/End: Complemental strand, 42430726 - 42430542
Alignment:
| Q |
184 |
aaacttgggggcctaaaacctttgctttagtggcagcccccttga---ggccctgaacccacccaacttagcacgagggagaatcaaatatgagaccttg |
280 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42430726 |
aaactcgggggcctaaagcctttgctttagtggcagcccccttggactggccctgaacccacccaacttagcatcagggagaatcaaatatgagaccttg |
42430627 |
T |
 |
| Q |
281 |
aggatgatcatactccaaagactcaagtcaatgccactaagctaatccaactgagttttgtattgaagttgcctactctcctatg |
365 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42430626 |
aggatgatcatactcccaggactcaagtcaataccactaagctaatccaactaggttttgtattgaagttgcctactctcctatg |
42430542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 26 - 118
Target Start/End: Complemental strand, 42432004 - 42431912
Alignment:
| Q |
26 |
ggctcgttcattgagttctattctaacatatgatttaactttgaaaatgaaaaatgattttaatgaaatggtgctcgttaagtatttgttgta |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432004 |
ggctcgttcattgagttctattctaacttatgatttaactttgaaaatgaaaaattattttaatgaaatggtgctcgttaagtatttgttgta |
42431912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 184 - 229
Target Start/End: Complemental strand, 49058194 - 49058149
Alignment:
| Q |
184 |
aaacttgggggcctaaaacctttgctttagtggcagcccccttgag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49058194 |
aaacttgggggcctaaaacctttgctttagtggcaacccccttgag |
49058149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 140 - 184
Target Start/End: Complemental strand, 42431316 - 42431272
Alignment:
| Q |
140 |
cgggaccggcccaatatatttttaagcctaaagtcgatttaaaga |
184 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
42431316 |
cgggaccggcccaatatatttttaggcctaaagtccatttaaaga |
42431272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 259 - 320
Target Start/End: Original strand, 21404819 - 21404880
Alignment:
| Q |
259 |
gagaatcaaatatgagaccttgaggatgatcatactccaaagactcaagtcaatgccactaa |
320 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||| | | ||||||||||||||||||| |
|
|
| T |
21404819 |
gagaatcaaacatgagaccttgaggaggagcatactctcaggtctcaagtcaatgccactaa |
21404880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 223
Target Start/End: Original strand, 3071786 - 3071818
Alignment:
| Q |
191 |
ggggcctaaaacctttgctttagtggcagcccc |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3071786 |
ggggcctaaaacccttgctttagtggcagcccc |
3071818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 238 - 298
Target Start/End: Original strand, 5795386 - 5795446
Alignment:
| Q |
238 |
cccacccaacttagcacgagggagaatcaaatatgagaccttgaggatgatcatactccaa |
298 |
Q |
| |
|
||||||||| || |||| |||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
5795386 |
cccacccaaattggcactggggagaatcaaacctgagaccttgaggaggagcatactccaa |
5795446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 184 - 228
Target Start/End: Complemental strand, 5816299 - 5816255
Alignment:
| Q |
184 |
aaacttgggggcctaaaacctttgctttagtggcagcccccttga |
228 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5816299 |
aaacttggggacctaaaacctttgctttagtggcagcccccttga |
5816255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 238 - 298
Target Start/End: Original strand, 12517731 - 12517790
Alignment:
| Q |
238 |
cccacccaacttagcacgagggagaatcaaatatgagaccttgaggatgatcatactccaa |
298 |
Q |
| |
|
||||||||| || |||| ||||||||||||| ||||||||||||||| || || ||||||| |
|
|
| T |
12517731 |
cccacccaa-ttggcaccagggagaatcaaacatgagaccttgaggaggagcaaactccaa |
12517790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 223
Target Start/End: Original strand, 4033307 - 4033339
Alignment:
| Q |
191 |
ggggcctaaaacctttgctttagtggcagcccc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4033307 |
ggggcctaaaacctttgctttagtggcagcccc |
4033339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 298
Target Start/End: Complemental strand, 36428811 - 36428751
Alignment:
| Q |
238 |
cccacccaacttagcacgagggagaatcaaatatgagaccttgaggatgatcatactccaa |
298 |
Q |
| |
|
||||||||| || |||| |||||||||||| ||||||||||||||| || |||||||||| |
|
|
| T |
36428811 |
cccacccaaattggcaccggggagaatcaaacatgagaccttgaggaggagcatactccaa |
36428751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 229
Target Start/End: Complemental strand, 49089473 - 49089436
Alignment:
| Q |
192 |
gggcctaaaacctttgctttagtggcagcccccttgag |
229 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
49089473 |
gggcctaaagcccttgctttagtggcagcccccttgag |
49089436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 11664864 - 11664908
Alignment:
| Q |
179 |
taaagaaacttgggggcctaaaacctttgctttagtggcagcccc |
223 |
Q |
| |
|
|||| ||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
11664864 |
taaaaaaactcgggggcctaaaacccttgctttaatggcagcccc |
11664908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University