View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_high_33 (Length: 261)
Name: NF19485_high_33
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 12290196 - 12290431
Alignment:
| Q |
11 |
cacagagatatatatcaataatggtgcctctatttttagtaacacattcatctttcttgtggatttacaaactttgctttttggaacactatcaattcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12290196 |
cacagagatatatatcaataatggtgcctctatttttagtaacacattcatctttcttgtggatttacaaactttgctttttggaacactatcaattcat |
12290295 |
T |
 |
| Q |
111 |
tctttaccattcatagacaagtctaacatatgcttatgaacacaaattaattttaactcgcattagatattcaatgatgactacctctttgttttggtcg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12290296 |
tctttaccattcatagacaagtctaacatatgcttgtgaacacaaattaattttaactcacattagatattcaatgatgactacctctttattttggtcg |
12290395 |
T |
 |
| Q |
211 |
tgtttagattatgtaacaaaacaaaatcaaccacat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12290396 |
tgtttagattatgtaacaaaacaaaatcaaccacat |
12290431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University