View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19485_high_8 (Length: 509)

Name: NF19485_high_8
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19485_high_8
NF19485_high_8
[»] chr2 (4 HSPs)
chr2 (4-466)||(37830904-37831366)
chr2 (131-170)||(13337302-13337341)
chr2 (110-158)||(1269490-1269538)
chr2 (100-156)||(14405195-14405251)
[»] chr7 (2 HSPs)
chr7 (184-272)||(28006672-28006760)
chr7 (100-156)||(6584906-6584962)
[»] chr1 (6 HSPs)
chr1 (204-279)||(8133528-8133603)
chr1 (9-170)||(15840926-15841091)
chr1 (184-279)||(2660746-2660841)
chr1 (80-166)||(41403016-41403102)
chr1 (340-414)||(8133655-8133730)
chr1 (100-170)||(46814481-46814551)
[»] scaffold0236 (1 HSPs)
scaffold0236 (133-277)||(10309-10452)
[»] chr3 (4 HSPs)
chr3 (184-276)||(24099163-24099255)
chr3 (102-170)||(19176501-19176569)
chr3 (131-170)||(19295879-19295918)
chr3 (102-170)||(43012374-43012442)
[»] chr6 (3 HSPs)
chr6 (97-169)||(34105407-34105479)
chr6 (80-166)||(20970423-20970509)
chr6 (3-48)||(34105321-34105366)
[»] chr4 (4 HSPs)
chr4 (114-170)||(2792288-2792344)
chr4 (93-153)||(31050693-31050753)
chr4 (81-170)||(2165486-2165574)
chr4 (131-168)||(32057141-32057178)
[»] scaffold0620 (1 HSPs)
scaffold0620 (98-169)||(3825-3896)
[»] scaffold0572 (1 HSPs)
scaffold0572 (80-166)||(6273-6359)
[»] scaffold0127 (1 HSPs)
scaffold0127 (80-166)||(31233-31319)
[»] scaffold0036 (2 HSPs)
scaffold0036 (182-269)||(64195-64282)
scaffold0036 (182-269)||(69337-69424)
[»] scaffold0200 (1 HSPs)
scaffold0200 (100-158)||(19380-19438)
[»] scaffold0119 (1 HSPs)
scaffold0119 (110-158)||(42164-42212)


Alignment Details
Target: chr2 (Bit Score: 386; Significance: 0; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 4 - 466
Target Start/End: Original strand, 37830904 - 37831366
Alignment:
4 atcacttttacttcgagatcgtaagttagtgtcttgtttcaagttatgggatggttaaggtgtcttatccgaacgtggagttgagggacgccctagtgat 103  Q
    ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37830904 atcacttttacttcgagatcggaagttagtgtctagtttcaagttatgggatggttaaggtgtcttatccgaacgtggagttgagggacgccctagtgat 37831003  T
104 ttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaagnnnnnnngtcatattttggtgtcttctacgacg 203  Q
    |||||||||||||| ||||||||| | ||||||||||||||||| ||||||||||||||||||||||       | ||||||||||||||||||||||||    
37831004 ttgtttctaaagtcaggtaagccgatcacttttgattcgaaatctgaagtcagtttcttgactcaagtttttttgccatattttggtgtcttctacgacg 37831103  T
204 aaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtgaggtaagggtttattggttttttagcat 303  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
37831104 aaccgaggattgattggtggtggaatctgaatgagtgttgaaatttggctcagttgtggttatgagaaggtgaggtaagggtttattggttttttagcat 37831203  T
304 tggatttggtgtgagtaccaggccataggtgtgtagattttgttcttgtggccattcgcgatgtagttatgaggttttgattcaacttttggctatgtgg 403  Q
    ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37831204 tggatttggtgtgagtagcaggcgataggtgtgtagattttgttcttgtggccattcgcgatgtagttatgaggttttgattcaacttttggctatgtgg 37831303  T
404 gtttgtgggggtttagctttgttagaggtttgtttttattagggtttaagatgtaccgtgtat 466  Q
    ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||    
37831304 gtttgtgggggtttagcttggttagaggtttgtttttattggggtttaagatgtaccatgtat 37831366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 131 - 170
Target Start/End: Original strand, 13337302 - 13337341
Alignment:
131 acttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    ||||||||||||||||||||||||||||  ||||||||||    
13337302 acttttgattcgaaatcggaagtcagttctttgactcaag 13337341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 110 - 158
Target Start/End: Original strand, 1269490 - 1269538
Alignment:
110 ctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtt 158  Q
    ||||||||||||  |||| | ||||||||||||| ||||||||||||||    
1269490 ctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagtt 1269538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 156
Target Start/End: Original strand, 14405195 - 14405251
Alignment:
100 tgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcag 156  Q
    ||||||| ||||||||||||||  |||| | ||||||||||||| ||||| ||||||    
14405195 tgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcag 14405251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 61; Significance: 6e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 184 - 272
Target Start/End: Original strand, 28006672 - 28006760
Alignment:
184 ttttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaag 272  Q
    |||||||||||||| || | |||| ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||    
28006672 ttttggtgtcttctccgtcaaacctaggattgattggtggtggaatccgaatgagtgtgggaatttggctcaattgtggtgatgagaag 28006760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 100 - 156
Target Start/End: Original strand, 6584906 - 6584962
Alignment:
100 tgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcag 156  Q
    ||||||| ||||||||||||||  |||| | ||||||||||||| ||||| ||||||    
6584906 tgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcag 6584962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 5e-23; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 204 - 279
Target Start/End: Original strand, 8133528 - 8133603
Alignment:
204 aaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtgaggt 279  Q
    ||||||||||| |||||||||||||| |||||||||| |||||||||| | |||||||||||||||||||||||||    
8133528 aaccgaggattaattggtggtggaattcgaatgagtgctgaaatttggttgagttgtggtgatgagaaggtgaggt 8133603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 15841091 - 15840926
Alignment:
9 ttttacttcgagatcgtaagttagtgtcttgtttcaagttatgg-gatggttaaggtgtcttatccgaacgt---ggagttgagggacgccctagtgatt 104  Q
    |||| ||||||||||| ||||||| |||| |||||||||| | | |||||||||||||| || |||||| ||   |||| ||||||   || ||| ||||    
15841091 ttttgcttcgagatcggaagttagcgtctagtttcaagtttttgtgatggttaaggtgttttctccgaatgtccgggagatgaggggttccttagggatt 15840992  T
105 tgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    |||||||| ||||||||  || | | ||||||||||||| ||||| |||||||||||||| |||||    
15840991 tgtttctagagtctggtgggctgatcacttttgattcgagatcgggagtcagtttcttgattcaag 15840926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 184 - 279
Target Start/End: Complemental strand, 2660841 - 2660746
Alignment:
184 ttttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtgaggt 279  Q
    ||||||| ||||||  |||  ||||||||||||||| ||||| |||  ||| |||||| | |||||||||||| |  |||||||||||||||||||    
2660841 ttttggtatcttctctgacataccgaggattgattgatggtgaaatatgaacgagtgtgggaatttggctcagctcaggtgatgagaaggtgaggt 2660746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 80 - 166
Target Start/End: Complemental strand, 41403102 - 41403016
Alignment:
80 ggagttgagggacgccctagtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgact 166  Q
    |||||||||||  | | |||||||||||||||| |||||||| ||||| | || ||||||||||   || |||||||||||||||||    
41403102 ggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtcagtttcttgact 41403016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 414
Target Start/End: Original strand, 8133655 - 8133730
Alignment:
340 attttgttcttgtggccattcgcgatgtagttatgaggttttgattcaacttttgg-ctatgtgggtttgtggggg 414  Q
    |||||||| ||||||||||||  |||| |||| ||||||||||  |||||||||||  ||||| ||||||||||||    
8133655 attttgtttttgtggccattcatgatgaagttgtgaggttttggctcaacttttggtttatgttggtttgtggggg 8133730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 100 - 170
Target Start/End: Complemental strand, 46814551 - 46814481
Alignment:
100 tgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    ||||||| ||||||||||||||  |||| | ||||||||||||| ||||| |||||| || ||| ||||||    
46814551 tgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagctttttggctcaag 46814481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0236 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0236
Description:

Target: scaffold0236; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 133 - 277
Target Start/End: Complemental strand, 10452 - 10309
Alignment:
133 ttttgattcgaaatcggaagtcagtttcttgactcaagnnnnnnngtcatattttggtgtcttctacgacgaaccgaggattgattggtggtggaatccg 232  Q
    ||||||||||| ||||  ||||||||||||||||||||       | | | ||||||||||||||   || ||||||||||||||||||||||||||||     
10452 ttttgattcgagatcgagagtcagtttcttgactcaagttgtttgg-cttgttttggtgtcttctctaacaaaccgaggattgattggtggtggaatcca 10354  T
233 aatgagtgttgaaatttggctcagttgtggtgatgagaaggtgag 277  Q
    |||||||    |||||| ||||||||| || ||||||||||||||    
10353 aatgagttcataaatttagctcagttgaggagatgagaaggtgag 10309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 184 - 276
Target Start/End: Complemental strand, 24099255 - 24099163
Alignment:
184 ttttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtga 276  Q
    |||| ||||||||| |||   ||||||  |||||||||||||| |||||||| ||||||| |||| |||| ||||||||||||||||||||||    
24099255 ttttagtgtcttctccgagagaccgagagttgattggtggtggtatccgaataagtgttggaattaggctaagttgtggtgatgagaaggtga 24099163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 19176501 - 19176569
Alignment:
102 atttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    ||||| ||||||||||||||  |||| | ||||||||||||| ||||| ||||||||  ||||||||||    
19176501 atttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 19176569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 131 - 170
Target Start/End: Complemental strand, 19295918 - 19295879
Alignment:
131 acttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    ||||||||||||| ||||||||| ||||||||||||||||    
19295918 acttttgattcgatatcggaagttagtttcttgactcaag 19295879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 43012374 - 43012442
Alignment:
102 atttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    ||||| ||||||||||||||   ||| | ||||||||||||| ||||| ||||||||  ||||||||||    
43012374 atttggttctaaagtctggtggcccgatcacttttgattcgagatcgggagtcagttctttgactcaag 43012442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 97 - 169
Target Start/End: Original strand, 34105407 - 34105479
Alignment:
97 tagtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaa 169  Q
    |||||||||||||||| ||| ||||  |||| | ||||||||||||| ||||| |||||||||||||||||||    
34105407 tagtgatttgtttctagagtttggtgggccgatcacttttgattcgagatcgggagtcagtttcttgactcaa 34105479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 80 - 166
Target Start/End: Complemental strand, 20970509 - 20970423
Alignment:
80 ggagttgagggacgccctagtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgact 166  Q
    |||||||||||  | | |||||||||||||||| |||||||| ||||| | || ||||||||||   || |||||||||||||||||    
20970509 ggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtcagtttcttgact 20970423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 34105321 - 34105366
Alignment:
3 gatcacttttacttcgagatcgtaagttagtgtcttgtttcaagtt 48  Q
    ||||| |||| ||||||||||| |||||||||||| ||||||||||    
34105321 gatcatttttgcttcgagatcggaagttagtgtctagtttcaagtt 34105366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 114 - 170
Target Start/End: Complemental strand, 2792344 - 2792288
Alignment:
114 agtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    ||||| ||| |||| | ||||||||||||| ||||||||||||||||||||||||||    
2792344 agtctagtaggccgatcacttttgattcgagatcggaagtcagtttcttgactcaag 2792288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 93 - 153
Target Start/End: Complemental strand, 31050753 - 31050693
Alignment:
93 gccctagtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagt 153  Q
    |||||| ||||||| ||||||||||||||  |||| | ||||||||||||| |||||||||    
31050753 gccctactgatttggttctaaagtctggtgggccgatcacttttgattcgagatcggaagt 31050693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 2165486 - 2165574
Alignment:
81 gagttgagggacgccctagtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaag 170  Q
    |||||||| || ||| | |||||||||||||| ||| ||||  |||| |  ||||||||| || ||||| ||||||||||||||||||||    
2165486 gagttgagtgatgccttggtgatttgtttctagagtttggtg-gccgatcgcttttgatttgagatcgggagtcagtttcttgactcaag 2165574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 168
Target Start/End: Original strand, 32057141 - 32057178
Alignment:
131 acttttgattcgaaatcggaagtcagtttcttgactca 168  Q
    |||||||||| || ||||||||||||||||||||||||    
32057141 acttttgatttgagatcggaagtcagtttcttgactca 32057178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0620
Description:

Target: scaffold0620; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 98 - 169
Target Start/End: Original strand, 3825 - 3896
Alignment:
98 agtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgactcaa 169  Q
    |||||||||||| || ||||||||  |||| | | ||||||||||| ||||| |||||||||||||||||||    
3825 agtgatttgtttttagagtctggtgggccgatcaattttgattcgagatcgggagtcagtttcttgactcaa 3896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0572 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0572
Description:

Target: scaffold0572; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 80 - 166
Target Start/End: Complemental strand, 6359 - 6273
Alignment:
80 ggagttgagggacgccctagtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgact 166  Q
    |||||||||||  | | |||||||||||||||| |||||||| ||||| | || ||||||||||   || |||||||||||||||||    
6359 ggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtcagtttcttgact 6273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0127 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0127
Description:

Target: scaffold0127; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 80 - 166
Target Start/End: Original strand, 31233 - 31319
Alignment:
80 ggagttgagggacgccctagtgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtttcttgact 166  Q
    |||||||||||  | | |||||||||||||||| |||||||| ||||| | || ||||||||||   || |||||||||||||||||    
31233 ggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtcagtttcttgact 31319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 182 - 269
Target Start/End: Complemental strand, 64282 - 64195
Alignment:
182 tattttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgag 269  Q
    |||||||| ||||||| ||||  || |||||||||| |||||||||||| |||| |||   |||||| ||||  ||||||||||||||    
64282 tattttggcgtcttctccgacagactgaggattgatcggtggtggaatctgaattagttcggaaattcggctatgttgtggtgatgag 64195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 182 - 269
Target Start/End: Complemental strand, 69424 - 69337
Alignment:
182 tattttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgag 269  Q
    |||||||| ||||||| ||||  || |||||||||| |||||||||||| |||| |||   |||||| ||||  ||||||||||||||    
69424 tattttggcgtcttctccgacagactgaggattgatcggtggtggaatctgaattagttcggaaattcggctatgttgtggtgatgag 69337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0200 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 100 - 158
Target Start/End: Original strand, 19380 - 19438
Alignment:
100 tgatttgtttctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtt 158  Q
    ||||||| | ||||||||||||  |||| | ||||||||||||| ||||||||||||||    
19380 tgatttggtcctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagtt 19438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 110 - 158
Target Start/End: Complemental strand, 42212 - 42164
Alignment:
110 ctaaagtctggtaagccggtgacttttgattcgaaatcggaagtcagtt 158  Q
    ||||||||||||  |||| | ||||||||||||| ||||||||||||||    
42212 ctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagtt 42164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University