View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_low_19 (Length: 365)
Name: NF19485_low_19
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 12 - 255
Target Start/End: Complemental strand, 56281139 - 56280896
Alignment:
| Q |
12 |
ccatcgtcaatttcagctactaagtcttaccagtaatataatactactattatcaaagcaatttgtttttagaatatcatattcaatatccaacaggacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56281139 |
ccatcgtcaatttcagctactaagtcttaccagtaatataatactactattatcaaagcaatttgtttttagaatatcatattcaatatccaacaggacc |
56281040 |
T |
 |
| Q |
112 |
cagaacatgttacataaataatacctgcatttgattgcatgtagatgaaatgaaaaataaacacaacagcatgattatcattagcatttgagcactcctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56281039 |
cagaacatgttacataaataatacctgcatttgattgcatgtagatgaaatgaaaaataaacacaacagcatgattatcattagcatttgagcactcctt |
56280940 |
T |
 |
| Q |
212 |
ttcatttctcttcttgaatcttcattcaaaataggctgatttaa |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56280939 |
ttcatttctcttcttgaatcttcattcaaaataggctgatttaa |
56280896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University