View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_low_22 (Length: 347)
Name: NF19485_low_22
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 118 - 336
Target Start/End: Original strand, 43451225 - 43451444
Alignment:
| Q |
118 |
atacgagattataaaaacttgaaaaaatgatgctttgttttttccctctacattcttttaatcacttgctgttatgc---attatgtacgataaattgtc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43451225 |
atacgagattataaaaacttgaaaaaatgat-ctttgtttttttcctctacattcttttaatcacttgctgttatgcattattatgtacgataaattgtc |
43451323 |
T |
|
| Q |
215 |
actgtacaaaggtttgtatgatacactttactggattattatactagtcnnnnnnnnaaagaaattcatcgtccaactataattttgatatagaagttct |
314 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43451324 |
actgtac-aaggtttgtatgatacactttactggattattatactagtcttttttttaaagaaattcatcgtccaactataattttgatatagaagttct |
43451422 |
T |
|
| Q |
315 |
tctaacattcccctgtccctat |
336 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43451423 |
tctaacattcccctgtccctat |
43451444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 13 - 81
Target Start/End: Original strand, 43451132 - 43451200
Alignment:
| Q |
13 |
aaaaacaactttgaacattaatattggatgcataccatgtaataataaattattaatcagggtgtcgtg |
81 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43451132 |
aaaaacaattttgaacattagtattggatgcataccatgtaataataaattattaaacagggtgtcgtg |
43451200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University