View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_low_25 (Length: 330)
Name: NF19485_low_25
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 41485019 - 41485326
Alignment:
| Q |
1 |
ttatcttgcttttagtctcttgtattttggggaaataatgctagaatattttcagccctttcggttcgtttttaaatatacagtaatctttctcaaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
41485019 |
ttatcttgcttttagtctcttgtattttggggaaataatgttagaatattttcagccctttcggttcgcttttaaatatacagtaatctttctcgaatat |
41485118 |
T |
|
| Q |
101 |
ctttgtgtttaacatcctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgttttagcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41485119 |
ctttgtgtttaacatcctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgttttagcat |
41485218 |
T |
|
| Q |
201 |
taccttcagagtagtttatccaaatgtctgttcagagttgttttgttttccaaacaagtatgatcttggcggaacctctaaggttctttgtcccaagtgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41485219 |
taccttcagagtagtttatccaaatgtctgttcagagttgttttgttttccaaacaagtatgatcttggcggaacctctaaggttctttgtcccaagtgt |
41485318 |
T |
|
| Q |
301 |
gaatatcc |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
41485319 |
gaatatcc |
41485326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University