View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_low_35 (Length: 257)
Name: NF19485_low_35
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 213
Target Start/End: Original strand, 38473839 - 38474038
Alignment:
| Q |
14 |
atatacttggaagaacatcgtgatgttatatatatagaataactccacctatgttatatatcttgactagtgatttgggactaaaacaccatatttctac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38473839 |
atatacttggaagaacatcgtgatgttatatatatagaataacaccacctatgttatatatcttgactagtgatttgggactaaaacaccatatttctac |
38473938 |
T |
|
| Q |
114 |
tatctacgatctacacctcacttgccacttgtactcaatgctaaaaaacttgcgcaacaatttctcatcgcttttcatagctagtaaactttcttttgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38473939 |
tatctacgatctacacctcacttgccacttgtactcaatgctaaaaaacttgcgcaacaatttctcatcgcttttcatagctagtaaactttcttttgtt |
38474038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 40 - 120
Target Start/End: Original strand, 38489744 - 38489824
Alignment:
| Q |
40 |
tatatatatagaataactccacctatgttatatatcttgactagtgatttgggactaaaacaccatatttctactatctac |
120 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||| ||||| | | |||||||||||||||||||||||||| ||||| |
|
|
| T |
38489744 |
tatatatatagaataactctatgtatgttatgtatctttactagcggtgtgggactaaaacaccatatttctactctctac |
38489824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Original strand, 38474146 - 38474176
Alignment:
| Q |
210 |
tgttctgtttaaattttattaacattgtaac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38474146 |
tgttctgtttaaattttattaacattgtaac |
38474176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University