View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_low_36 (Length: 256)
Name: NF19485_low_36
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 35991358 - 35991133
Alignment:
| Q |
19 |
tcataaacttggagtacaaggtgtttttacgacggattttcccacaaaacctcccgtgcaatttgattacaccggtaatgtaagtcgttcgttgtggcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
35991358 |
tcataaacttggagtacaaggtgtttttacgacggattttcccacaaaacctcccgtgcaatttgattacaccggtaatgtgagtcggtcgttgtggcaa |
35991259 |
T |
 |
| Q |
119 |
ccgattcaagggactaaagttactaagttgagatttggatcaagggttcaggttgttttgcaagatactagtattgttactcctgagaatcaccctattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35991258 |
ccgattcaagggactaaagttactaagttgagatttggatcaagggttcaggttgttttgcaagatactagtattgttactcctgagaatcaccctattc |
35991159 |
T |
 |
| Q |
219 |
atcttcatggatatgatttctatatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35991158 |
atcttcatggatatgatttctatatt |
35991133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 228
Target Start/End: Complemental strand, 31164931 - 31164867
Alignment:
| Q |
164 |
gttcaggttgttttgcaagatactagtattgttactcctgagaatcaccctattcatcttcatgg |
228 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| || |||| |||||||||| ||| ||||||| |
|
|
| T |
31164931 |
gttcagattgttttgcaggatactagtattgtaacagttgaggatcaccctatgcatgttcatgg |
31164867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 41 - 237
Target Start/End: Complemental strand, 32272126 - 32271930
Alignment:
| Q |
41 |
gtttttacgacggattttcccacaaaacctcccgtgcaatttgattacaccggtaatgtaagtcgttcgttgtggcaaccgattcaagggactaaag-tt |
139 |
Q |
| |
|
|||||||| || |||||||| ||||||| ||||| |||| ||||||||||| || || || ||||| | |||||||| ||| |||||||||| || |
|
|
| T |
32272126 |
gtttttaccactgattttccagcaaaaccacccgttaaattcgattacaccggcaacgtgagccgttccctctggcaacctgttcccgggactaaagctt |
32272027 |
T |
 |
| Q |
140 |
actaagttgagatttggatcaagggttcaggttgttttgcaagatactagtattgttactcctgagaatcaccctattcatcttcatggatatgattt |
237 |
Q |
| |
|
|| ||||||| |||||||||||||| || |||| ||||||||||| |||||||||||||||||||||||||| ||||| |||||||| |||||||| |
|
|
| T |
32272026 |
ac-aagttgaagtttggatcaagggtgcaaattgtgttgcaagataccagtattgttactcctgagaatcacccaattcaccttcatgggtatgattt |
32271930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 239
Target Start/End: Original strand, 25093150 - 25093216
Alignment:
| Q |
173 |
gttttgcaagatactagtattgttactcctgagaatcaccctattcatcttcatggatatgatttct |
239 |
Q |
| |
|
||||||||||||||| | || | || ||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
25093150 |
gttttgcaagatactggaatgttaacacctgagaatcatcctattcatcttcatggatttaatttct |
25093216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 237
Target Start/End: Original strand, 22603627 - 22603691
Alignment:
| Q |
173 |
gttttgcaagatactagtattgttactcctgagaatcaccctattcatcttcatggatatgattt |
237 |
Q |
| |
|
||||||||||||||||||||| || | |||||| ||||||| | ||||||||||| |||||||| |
|
|
| T |
22603627 |
gttttgcaagatactagtattcttggtgctgagagtcaccctttgcatcttcatggttatgattt |
22603691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University