View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_low_42 (Length: 223)
Name: NF19485_low_42
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 12321224 - 12321042
Alignment:
| Q |
20 |
attgacaggtctactttcttttttgactatttcttttctcatcctactgatttcttgcacgccctacaaattttggattaatataatctgaaaacgtaaa |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||| ||| |||||||| |||| ||||||| |||||||||| |
|
|
| T |
12321224 |
attgacaggtctactttcatttttgactatttcttttttca-cctactgatttcttgcacgcgctagaaattttgaatta-tataatccaaaaacgtaaa |
12321127 |
T |
 |
| Q |
120 |
acacttaagaaaaacttctataacactccattttttaggattttataatctgaacagagcatacgagaagattgaaaggcgaaaa |
204 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12321126 |
acacttgagaaaaacttctataacactccattttttcggattttataatctgaatagagcatacgagaagattgaaaggcgaaaa |
12321042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University