View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19485_low_44 (Length: 221)
Name: NF19485_low_44
Description: NF19485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19485_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 23 - 202
Target Start/End: Complemental strand, 13637110 - 13636929
Alignment:
| Q |
23 |
gacccccatatgttcaaactagaaattttttagcatcacactcggtnnnnnnnn-taaaactacctt-gtgtgttgcacaagtgaatcacaatctagata |
120 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
13637110 |
gacccccatatgtccaaactagaagttttttagcatcacactcggtaaaatataataaaactacctttgtgtgttgcacaagtgagtcacaatctagata |
13637011 |
T |
 |
| Q |
121 |
attttatttttggtgtttttacatgtctttggaaagagaatcacacaattttcctcttttataaagtgttttccttttcctc |
202 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
13637010 |
atgttatttttggtgtttttacatgtctttggaaagagaatcacacaattttactcttttatgaattgttttccttttcctc |
13636929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 77 - 183
Target Start/End: Complemental strand, 13655612 - 13655507
Alignment:
| Q |
77 |
taaaactaccttgtgtgttgcacaagtgaatcacaatctagataattttatttttggtgtttttacatgtctttggaaagagaatcacacaattttcctc |
176 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||| ||||||| |||||||| ||||| ||||||||||||| | ||||||| ||| |||||| |
|
|
| T |
13655612 |
taaaactactttgtgtgttgcacaagtgaatcacaaaatagtgaatttta-ttttggtgcttttatatgtctttggaaaaaaaatcacaaaatcttcctc |
13655514 |
T |
 |
| Q |
177 |
ttttata |
183 |
Q |
| |
|
||||||| |
|
|
| T |
13655513 |
ttttata |
13655507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 139 - 180
Target Start/End: Complemental strand, 14999500 - 14999459
Alignment:
| Q |
139 |
ttacatgtctttggaaagagaatcacacaattttcctctttt |
180 |
Q |
| |
|
|||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
14999500 |
ttacatgtctttggcatgagaatcacataattttcctctttt |
14999459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 139 - 180
Target Start/End: Complemental strand, 29468353 - 29468312
Alignment:
| Q |
139 |
ttacatgtctttggaaagagaatcacacaattttcctctttt |
180 |
Q |
| |
|
||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
29468353 |
ttacatgtcttcggcaagagaatcacacaattctcctctttt |
29468312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University