View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19486_high_16 (Length: 402)
Name: NF19486_high_16
Description: NF19486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19486_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 73 - 393
Target Start/End: Original strand, 2223910 - 2224236
Alignment:
| Q |
73 |
agttcttatctcacgatgagaactgcatacata------tgcaggggatcactgcatgaagccatttgtgatatctcaaccagagatcaatgtatacgga |
166 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223910 |
agttcttatctcactatgagaactgcatgcatatgcatatgcaggggatcactgcatgaagccatttgtgatatctcaaccagagatcaatgtatacgga |
2224009 |
T |
 |
| Q |
167 |
cgaacaaaatcagatgagtttgtagtggtggcaagtgatggtctttgggatgtagtatcaaataattttgtttgtgaagttgttagaagttgccttcaag |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2224010 |
cgaacaaaatcagatgagtttgtagtggtggcaagtgatggtctttgggatgtagtatcaaataattttgtttgtgaagttgttagaagttgccttcaag |
2224109 |
T |
 |
| Q |
267 |
gtcatatgaggaggcataatatgaaagaagttcacaatcacactattaaaagttatgcagcagaggctgctgcaatcttagctgaattggctatggctaa |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2224110 |
gtcatatgaggaggcataatatgaaagaagatcacaatcacactattaaaagttatgcagcagaggctgctgcaatcttagctgaattggctatggctaa |
2224209 |
T |
 |
| Q |
367 |
gggaagcaaagacaacataagtattat |
393 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
2224210 |
gggaagcaaagacaacataagtgttat |
2224236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University