View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19486_high_35 (Length: 279)
Name: NF19486_high_35
Description: NF19486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19486_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 25896494 - 25896235
Alignment:
| Q |
1 |
gtgaagttcatatcaatgaacattctgcatttcattttccatcgctgaagagattatatatcaacttaggcgttatgatttcagaagctgccttactctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
25896494 |
gtgaagttcatatcaatgaacattctgcatttcattttccatcactgaagatgttatatatcgacttaggcgttatgatttcagaagttgctttactctc |
25896395 |
T |
|
| Q |
101 |
tggttgccccggccttgaaactttggatggttacttttgctgtgaccctccagactatgtcaccaaacttctcattccaccttcgtccagatccaagaga |
200 |
Q |
| |
|
||| |||||| |||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25896394 |
tggctgccccagcctggaaattttcgatggttacttttgctgtgaccctccagactatgtcaccaaacttctcattccaccttcctccagatccaagaga |
25896295 |
T |
|
| Q |
201 |
tcgaaatccaccactgacaatttcacctggagctggagttaccttaatgtacgtggaaat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25896294 |
tcgaaatccaccactgacaatttcacctggagctggagttaccttaatgtacgtggaaat |
25896235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University