View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19486_high_38 (Length: 230)
Name: NF19486_high_38
Description: NF19486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19486_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 32376656 - 32376854
Alignment:
| Q |
15 |
tataataattgaatcctcggcggcgctacacgtgtgcatccaccagagagcttttgaatctacatctaaagacgaaaatcatgattcaacgctttctcgg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376656 |
tataataattgaatcctcggcggcgctacacatgtgcatccaccagagagcttttgaatctacatctaaagacgaaaatcatgattcaacgctttctcgg |
32376755 |
T |
 |
| Q |
115 |
cgtttgcacatgttagcattgcagatgatttcaaaccttataactatcatagtataatacaaattaaaagacaattattatttttaaatattattatag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376756 |
cgtttgcacatgttagcattgcagatgatttcaaaccttataactatcatagtatactacaaattaaaagacaattattatttttaaatattattatag |
32376854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University