View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19486_low_32 (Length: 305)
Name: NF19486_low_32
Description: NF19486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19486_low_32 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 11 - 305
Target Start/End: Complemental strand, 29662315 - 29662020
Alignment:
| Q |
11 |
atcatcaataacactaggcaaagagaatttatattatattttagttt-ctagttgatataatttttcaaattaagctaggagaattaatggcttctatca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662315 |
atcatcaataacactaggcaaagagaatttatattatattttagttttctagttgatataatttttcaaattaagctaggagaattaatggcttctatca |
29662216 |
T |
 |
| Q |
110 |
ccatgttgccaatggttccaacaacaggaagagtctttgcagctacaggtgcaaagggtactacaggtggtggcagtagcaagcaagagaaaggtttttg |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662215 |
ccatgttgccaatggttccaacaacgggaagagtctttgcagctacaggtgcaaagggtactacaggtggtggcagtagcaagcaagagaaaggtttttg |
29662116 |
T |
 |
| Q |
210 |
ggattggattgttggtggtttaacaaaagaagatcagttctatgaaactgatcctattctcaagaaggttgaagagaagaataatagtagaggcac |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662115 |
ggattggattgttggtggtttaacaaaagaagatcagttctatgaaactgatcctattctcaagaaggttgaagagaagaataatagtagaggcac |
29662020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University