View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19486_low_35 (Length: 288)
Name: NF19486_low_35
Description: NF19486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19486_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 2488916 - 2489196
Alignment:
| Q |
1 |
agagcctgaatacagaaatggaaagctgatcattccatgcaacaggttagaccggcaaattttgctgcatgaacaatctaacttttatatacttacttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488916 |
agagcctgaatacagaaatggaaaactgatcattccatgcaacaggttagaccggcaaattttgctgcatgaacaatctaacttttatatacttacttaa |
2489015 |
T |
|
| Q |
101 |
ttgtatttcgaaacagtttgtcccatgctctgggaatattccaggcgggaaaattcagtgacagagattcattgaagttagaagctcaagcagtaacatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489016 |
ttgtatttcgaaacagtttgtcccatgctctgggaatattccaggcgggaaaattcggtgacagagattcattgaagttagaagctcaagcagtaacatc |
2489115 |
T |
|
| Q |
201 |
tgaggtttgcagtgcttgtcgttattgtatttagttgtgaataatatctaccaggtactgatataatctgtgtgtcctttg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489116 |
tgaggtttgcagtgcttgtcgttattgtatttagttgtgaataatatctaccaggtactgatataatctgtgtgtcctttg |
2489196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University