View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19486_low_38 (Length: 243)
Name: NF19486_low_38
Description: NF19486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19486_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 19159300 - 19159073
Alignment:
| Q |
1 |
attggcagcaatattattccgataagaacaacttctttgatcagcacagtttcgatgaatttccctatgcaagggcagtctgatcgagagataccatggt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19159300 |
attggcagcagtattattccgataaggataacttctttgatcagcacaatttcgatgaatttccctatgcaagggcaggacgatcgagagataccatggt |
19159201 |
T |
 |
| Q |
101 |
cctacgcgatggtggttatcaggtgcataatcatacgcgttccaattatcgttcctacgggaaagagaatgtgcaccctgtggataccattgaggctgat |
200 |
Q |
| |
|
| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
19159200 |
cttgcgcgatggtggttatcaggtgcaaaatcatacgcgttccaattatcgttcctacgggaaagagaatatgcaccatgtggataccattgaggttgat |
19159101 |
T |
 |
| Q |
201 |
cacatgaaataaaggaaggtacacaggt |
228 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
19159100 |
cacgtgaaataaaggaaggtacacaggt |
19159073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University