View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19487_high_15 (Length: 256)

Name: NF19487_high_15
Description: NF19487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19487_high_15
NF19487_high_15
[»] chr3 (1 HSPs)
chr3 (99-256)||(52535245-52535397)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 99 - 256
Target Start/End: Complemental strand, 52535397 - 52535245
Alignment:
99 ttagcattatttgccttcaactaccaataagacaacaacttaactttgtcgataagatattgctgagattcttctttgtgtcgaaagatacggaaattta 198  Q
    ||||||||||||||||||||||||||||||||||||     | |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||    
52535397 ttagcattatttgccttcaactaccaataagacaac-----agctttgtcgataagatattgctgagattcttctttgtgtcgaaagatacgagaattta 52535303  T
199 tttccttcgaagtaacccaaacatgagatggccaaataatatgtaacggcgaacgaac 256  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||    
52535302 tttccttcgaagtaacccaaacatgcgatggccaaataatatgtaacgacgaacgaac 52535245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University