View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19487_high_15 (Length: 256)
Name: NF19487_high_15
Description: NF19487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19487_high_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 99 - 256
Target Start/End: Complemental strand, 52535397 - 52535245
Alignment:
| Q |
99 |
ttagcattatttgccttcaactaccaataagacaacaacttaactttgtcgataagatattgctgagattcttctttgtgtcgaaagatacggaaattta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52535397 |
ttagcattatttgccttcaactaccaataagacaac-----agctttgtcgataagatattgctgagattcttctttgtgtcgaaagatacgagaattta |
52535303 |
T |
 |
| Q |
199 |
tttccttcgaagtaacccaaacatgagatggccaaataatatgtaacggcgaacgaac |
256 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
52535302 |
tttccttcgaagtaacccaaacatgcgatggccaaataatatgtaacgacgaacgaac |
52535245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University