View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19487_high_18 (Length: 238)
Name: NF19487_high_18
Description: NF19487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19487_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 220
Target Start/End: Complemental strand, 46739936 - 46739723
Alignment:
| Q |
8 |
tcgaagaaaatatattgcagtgttttcactaatttatagtgtttttatgtactactaaaagtagtatttaattttaaagttaaatctatttttcgtatct |
107 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46739936 |
tcgaataaaatatattgtagtgttttcactaatttatagtgtttttatatactactaaaagtagtatttaattttaaagttaaatctatttttcgtatct |
46739837 |
T |
 |
| Q |
108 |
atacaatatttagtattttagtttactccnnnnnnnnttatctatttttaatctctaccttttat-aaaaaatacggtgctttctgaaagtttatcttcc |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||| |
|
|
| T |
46739836 |
atacaatatttagtattttagtttagtccaaaaaaaattatctatttttagtctctaccttttataaaaaaatatggtgctttctgaaaatttatcttcc |
46739737 |
T |
 |
| Q |
207 |
aaataagcgatttc |
220 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
46739736 |
aaatgagcgatttc |
46739723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University