View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19487_high_20 (Length: 207)
Name: NF19487_high_20
Description: NF19487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19487_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 52535265 - 52535093
Alignment:
| Q |
16 |
aatatgtaacggcgaacgaacatgttttgaaaaatgactgaattgaattaggtggttagataggcgcaccaggttcaccaaaatgttgtctaaccattgc |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
52535265 |
aatatgtaacgacgaacgaacatgttttgaaaaatgactgaattgaattaggtggttagataggcgcaccaggttcaccaaaacgttatctaaccattgc |
52535166 |
T |
 |
| Q |
116 |
agcaccaagaaccaaattctttcaaagaagtcacaactcataaacaaatgacctgcaatttcaatgttacctc |
188 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52535165 |
agcaccaagaaccgaattctttcagagaagtcacaactcataaacaaatgacctgcaatttcaatgttacctc |
52535093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University