View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19488_high_45 (Length: 236)

Name: NF19488_high_45
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19488_high_45
NF19488_high_45
[»] chr1 (1 HSPs)
chr1 (3-219)||(39279695-39279904)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 3 - 219
Target Start/End: Original strand, 39279695 - 39279904
Alignment:
3 gatagatcgattagattcttagtacttagttgggcttaacatgtcaacgtcaccgcaatatataggcaaaatcaggcgaacagagcaccattagctctta 102  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39279695 gatagattgattagattcttagtacttagttgggcttaacatgtcaacgtcaccgcaatatataggcaaaatcaggcgaacagagcaccattagctctta 39279794  T
103 agttttaccttgtattgtaaaattgaaataaatgatatgtgcannnnnnnnnnnnnnnnnnatattgctttctagtaagatttggtgtatatatggatgt 202  Q
    |||||||||||||||||||||||||||||||||||||||||||                  |||||||||||||||||||||||||||||||||||||||    
39279795 agttttaccttgtattgtaaaattgaaataaatgatatgtgca-------tttttttttttatattgctttctagtaagatttggtgtatatatggatgt 39279887  T
203 tttgatatgtgaagtgt 219  Q
    |||||||||||||||||    
39279888 tttgatatgtgaagtgt 39279904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University