View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19488_high_50 (Length: 213)

Name: NF19488_high_50
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19488_high_50
NF19488_high_50
[»] chr7 (2 HSPs)
chr7 (98-197)||(47875358-47875457)
chr7 (98-128)||(47870105-47870135)


Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 98 - 197
Target Start/End: Complemental strand, 47875457 - 47875358
Alignment:
98 tatgaagatcaaagtttgacaattaagtacatagatgaatcatttgtacattgtatgacaacattgaatttagatagtttcaatttcaaaatcaactctc 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
47875457 tatgaagatcaaagtttgacaattaagtacatagatgaatcatttgcacattgtatgacaacattgaatttagatagtttcaatttcaaaatcaactctc 47875358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 128
Target Start/End: Original strand, 47870105 - 47870135
Alignment:
98 tatgaagatcaaagtttgacaattaagtaca 128  Q
    |||||||||||||||||||||||||||||||    
47870105 tatgaagatcaaagtttgacaattaagtaca 47870135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University