View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_high_51 (Length: 212)
Name: NF19488_high_51
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_high_51 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 3 - 212
Target Start/End: Complemental strand, 38564772 - 38564562
Alignment:
| Q |
3 |
tgggtagattattctaagttga-gtggccctatacgtgcctcctatcattgacttgcgtagaacgcataatatgcatgcaccgcggcttcaaattcatca |
101 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38564772 |
tgggtaggatattctaagttgaagtggccctatacgtgcctcttatcattgacttgcgtagaacgcataatatgcatgcaccgcggcttcaaactcatca |
38564673 |
T |
|
| Q |
102 |
tatgataataaaactttgcacaatcatttaaaagattaagttttgctatatatgactctagctagccactattgaattttaagatgagaacacagaggag |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38564672 |
tatgataataaaaccttgcacaatcatttaaaagattaagttttgctatatatgactctagctagccactattgaattttaagatgagaacacagaggag |
38564573 |
T |
|
| Q |
202 |
gtgatagtggt |
212 |
Q |
| |
|
| ||||||||| |
|
|
| T |
38564572 |
gggatagtggt |
38564562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University