View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_high_54 (Length: 202)
Name: NF19488_high_54
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_high_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 68 - 182
Target Start/End: Original strand, 36310021 - 36310135
Alignment:
| Q |
68 |
aacctgtggctgggagttttccttcggtgcattttcatgttcctggccaaaatgcaaaaggagaggaaggaatatttgttttgatttccttacctactaa |
167 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36310021 |
aacctggggctgggagttttccttcggtgcattttcatgttcctggccaaaatgcaaaaggagaggaaggaatatttgttttgatttccttacctactaa |
36310120 |
T |
 |
| Q |
168 |
agttatgacagcttt |
182 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36310121 |
agttatgacagcttt |
36310135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 60
Target Start/End: Complemental strand, 18220900 - 18220862
Alignment:
| Q |
22 |
tagtggcagtggggataaaaagtctgagaaagcagtgaa |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18220900 |
tagtggcagtggggataaaaagtctgagaaagcagtgaa |
18220862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University