View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_33 (Length: 307)
Name: NF19488_low_33
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 87 - 304
Target Start/End: Complemental strand, 24144510 - 24144287
Alignment:
| Q |
87 |
acgcatataatgttttagaattttttggtatcaagcaattaaagatcattggcacattgtataggagagaaaggaacaaatatgttgaaaaagagtgtaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24144510 |
acgcatataatgttttagaattttttggtatcaagcaattaaagatcattggcacattgtataggagagaaaggaacaaatatgttgaaaaagagtgtaa |
24144411 |
T |
|
| Q |
187 |
acnnnnnnnngggttactata------atacgaagtttccactatcataaagtaatgattaaactctatcgaaaaacatatgagcatgcaatgtgaattc |
280 |
Q |
| |
|
|| || |||||||| |||||||||||||||||||| ||||||| | ||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
24144410 |
acttttttttggattactatattataggtacgaagtttccactatcattaagtaataactaaactctatcgagaaacatatgagcacgcaatgtgaattc |
24144311 |
T |
|
| Q |
281 |
tcctctcctaaccgaatttacttc |
304 |
Q |
| |
|
||||||||| ||||||||| |||| |
|
|
| T |
24144310 |
tcctctcctgaccgaattttcttc |
24144287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 24144634 - 24144548
Alignment:
| Q |
1 |
tactggcatagcgtaaatgcattgcaatgtgtgatttctcatgtggggagggaatatttgagagtttactcaatttaatttaaccaa |
87 |
Q |
| |
|
||||||||| |||| |||||||| |||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
24144634 |
tactggcatggcgtgaatgcatttcaatgtgttatttctcatgtggggagggcacatttgagagtttactcaatttaatttaaccaa |
24144548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University