View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_34 (Length: 301)
Name: NF19488_low_34
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 4 - 167
Target Start/End: Original strand, 24144815 - 24144978
Alignment:
| Q |
4 |
aaattgatggataacagttttaagttgatagtttgaaaatcagttttcagacgtaaacgacactaattcatttgggtggctctttagcatttctaaagtg |
103 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24144815 |
aaattgatgggtgacagttttaagttgatagtttgaaaatcacttttcagacgtaaacgacactaattcatttgggtggctcttttgcatttctaaagtg |
24144914 |
T |
 |
| Q |
104 |
ggtgtgtaatgtgttgttgggtttgttaatagtttttcacattaacattaactttgagtccaag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24144915 |
ggtgtgtaatgtgttgttgggtttgttaatagtttttcacattaacattaactttgagtccaag |
24144978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 221 - 282
Target Start/End: Original strand, 24145049 - 24145110
Alignment:
| Q |
221 |
acaagcaccaagcaataaataggcattgcacatcttaatcttatcttaatatacgagcacca |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24145049 |
acaagcaccaagcaataaataggcattgcacatcttaatcttatcttaatatacgagcacca |
24145110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University