View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19488_low_35 (Length: 299)

Name: NF19488_low_35
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19488_low_35
NF19488_low_35
[»] chr1 (1 HSPs)
chr1 (40-284)||(41737376-41737604)


Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 40 - 284
Target Start/End: Original strand, 41737376 - 41737604
Alignment:
40 tgtagtgagtgaggtctctgaaaatggaaatggtgaggtgagtgtgaggtggagtgtatagtctgaaagaaatatgatactatatataacatatacaacc 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||                || |    
41737376 tgtagtgagtgaggtctctgaaaatggaaatggtgaggtgagtgtgaggtgaagtgtatagtctgaaagaaacatgatac----------------aaac 41737459  T
140 acatgcaatatataaacgaattgaacatgtaatattacagtatgataggcgtggttgtgatatttttgggattgtattgttttatatgggggaagagcaa 239  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
41737460 acatgcaatatataaacgaattgaacatgtaatattatagtatgataggcgtggttgtgatatttttgggaatgtattgttttatatgggggaagagcaa 41737559  T
240 agatctcaaccctctaagtaatgaacaagctggtgttgctaatgt 284  Q
    |||| |||||||||||||||||||||||||||||||||| |||||    
41737560 agatatcaaccctctaagtaatgaacaagctggtgttgccaatgt 41737604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University