View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_37 (Length: 286)
Name: NF19488_low_37
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 6421302 - 6421031
Alignment:
| Q |
1 |
ctatcgttggttggtatgttatgtagggacacaagaaatcatataatatttatgtcgagtgaatttaggatgtttttatggattcaaattttaaaacata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6421302 |
ctatcgttggttggtatgttatgtagggacacaagaaatcatatagtatttatgtcgagtgaatttaggatgtttttatggattcaaattttaaaacata |
6421203 |
T |
 |
| Q |
101 |
ttttgtttttcctgtaagtttcacaatttgagcttaaattctcgatgtttgatcttgattggataatctagatatttgtgattgcgtgcagatcatgttt |
200 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||| || |||| ||||||||| |
|
|
| T |
6421202 |
ttttgtttttctt-taagtttcacaatttgagcttgaaatctcgatgtttgatcttgattggataatctagatacttgtgaccgcatgcaaatcatgttt |
6421104 |
T |
 |
| Q |
201 |
tcaaactatatagacaaagactaatcctttaaaatatatgattcacgataaagactaatccttcaaaatatat |
273 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6421103 |
tcaaactatatagataaagactaatcctttaaaatatatggttcacgataaagactaatccttcaaaatatat |
6421031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University