View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_46 (Length: 236)
Name: NF19488_low_46
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 3 - 219
Target Start/End: Original strand, 39279695 - 39279904
Alignment:
| Q |
3 |
gatagatcgattagattcttagtacttagttgggcttaacatgtcaacgtcaccgcaatatataggcaaaatcaggcgaacagagcaccattagctctta |
102 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39279695 |
gatagattgattagattcttagtacttagttgggcttaacatgtcaacgtcaccgcaatatataggcaaaatcaggcgaacagagcaccattagctctta |
39279794 |
T |
 |
| Q |
103 |
agttttaccttgtattgtaaaattgaaataaatgatatgtgcannnnnnnnnnnnnnnnnnatattgctttctagtaagatttggtgtatatatggatgt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39279795 |
agttttaccttgtattgtaaaattgaaataaatgatatgtgca-------tttttttttttatattgctttctagtaagatttggtgtatatatggatgt |
39279887 |
T |
 |
| Q |
203 |
tttgatatgtgaagtgt |
219 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39279888 |
tttgatatgtgaagtgt |
39279904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University