View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_47 (Length: 233)
Name: NF19488_low_47
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 41 - 216
Target Start/End: Complemental strand, 38457561 - 38457387
Alignment:
| Q |
41 |
atttaaaaaatccatcccatcctcttttgtgaataaaaattgtatttaattaaaatatctcttctctcatctcctattttgaatcaattatatgtttaat |
140 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
38457561 |
atttaaaaaatccctcccatcctcttt-gtgaataaaaattgtatttaatgaaaatatctcttctcccatctcctgttttgaatcaattatatgtttaat |
38457463 |
T |
|
| Q |
141 |
taaaattctccccttcccctatgaaccaaaaagatcctaagggcgattgaagtttatgaggcatcaacataataac |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38457462 |
taaaattctccccctcccctatgaaccaaaaagaccctaagggcgattgaagtttatgaggcatcaacacaataac |
38457387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University