View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_50 (Length: 227)
Name: NF19488_low_50
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 603323 - 603187
Alignment:
| Q |
1 |
cactcattggaaagttgaaagtgtaaactcttataggacataacgtggtgtgttcatggccatattaatttaaaatacaaatggaaataaggaaaatgtc |
100 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
603323 |
cactcattggaaatttgaaagtgaaaactcttataggacataacgtggtgtgttcatggccatattaatttaaaatacaaatggaaataaggaaaatgtc |
603224 |
T |
 |
| Q |
101 |
ataaattgattatattttgaaatgactagtgttaata |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
603223 |
ataaattgattatattttgaaatgactagtgttaata |
603187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 174 - 212
Target Start/End: Complemental strand, 603156 - 603118
Alignment:
| Q |
174 |
taatatagttaataattgttagttaattagtattatatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
603156 |
taatatagttaataattgttagttaattagtattatatt |
603118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University