View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_51 (Length: 213)
Name: NF19488_low_51
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 98 - 197
Target Start/End: Complemental strand, 47875457 - 47875358
Alignment:
| Q |
98 |
tatgaagatcaaagtttgacaattaagtacatagatgaatcatttgtacattgtatgacaacattgaatttagatagtttcaatttcaaaatcaactctc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875457 |
tatgaagatcaaagtttgacaattaagtacatagatgaatcatttgcacattgtatgacaacattgaatttagatagtttcaatttcaaaatcaactctc |
47875358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 128
Target Start/End: Original strand, 47870105 - 47870135
Alignment:
| Q |
98 |
tatgaagatcaaagtttgacaattaagtaca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47870105 |
tatgaagatcaaagtttgacaattaagtaca |
47870135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University