View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19488_low_53 (Length: 209)
Name: NF19488_low_53
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19488_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 31 - 181
Target Start/End: Complemental strand, 41263817 - 41263667
Alignment:
| Q |
31 |
aatgaattaataaattgctctgaagttactctctcaatcctctctacaaagacctttgttcgtaaatagaaatactcatttgacnnnnnnntattccact |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41263817 |
aatgaattaataaattgctctgaagttactctctcaatcctctctacaaagacctttgttcgtaaatagaaatactcatttgacaaaaaaatattccact |
41263718 |
T |
 |
| Q |
131 |
tctgcaaagtaatctggtttctttagtttgcacctattgagttggctgtag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263717 |
tctgcaaagtaatctggtttctttagtttgcacctattgagttggctgtag |
41263667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 181
Target Start/End: Original strand, 41950045 - 41950089
Alignment:
| Q |
137 |
aagtaatctggtttctttagtttgcacctattgagttggctgtag |
181 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
41950045 |
aagtaatctggtttgttttgtttgcacctattgagttggctgtag |
41950089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University