View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19488_low_55 (Length: 202)

Name: NF19488_low_55
Description: NF19488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19488_low_55
NF19488_low_55
[»] chr1 (1 HSPs)
chr1 (68-182)||(36310021-36310135)
[»] chr8 (1 HSPs)
chr8 (22-60)||(18220862-18220900)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 68 - 182
Target Start/End: Original strand, 36310021 - 36310135
Alignment:
68 aacctgtggctgggagttttccttcggtgcattttcatgttcctggccaaaatgcaaaaggagaggaaggaatatttgttttgatttccttacctactaa 167  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36310021 aacctggggctgggagttttccttcggtgcattttcatgttcctggccaaaatgcaaaaggagaggaaggaatatttgttttgatttccttacctactaa 36310120  T
168 agttatgacagcttt 182  Q
    |||||||||||||||    
36310121 agttatgacagcttt 36310135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 60
Target Start/End: Complemental strand, 18220900 - 18220862
Alignment:
22 tagtggcagtggggataaaaagtctgagaaagcagtgaa 60  Q
    |||||||||||||||||||||||||||||||||||||||    
18220900 tagtggcagtggggataaaaagtctgagaaagcagtgaa 18220862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University