View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1948_high_11 (Length: 295)
Name: NF1948_high_11
Description: NF1948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1948_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 29 - 274
Target Start/End: Complemental strand, 12019022 - 12018780
Alignment:
| Q |
29 |
tcaaatagttttaggatatgttcggttgtttacagaaaa-ttgaaggtgtttaggctttattttgataaatagcttatctcacaatttcttatcatgata |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12019022 |
tcaaatagttttaggatatgttcggttgtttacaaaaaaattgaaggtgtttaggctttattttgataaatagcttatctcacaatttcttatcatgata |
12018923 |
T |
 |
| Q |
128 |
aaaacatatatatacgatgtttttatagtaagagaaaaaataaagtcaaattannnnnnnataagctataaactgtattcataagtattgttatcttatg |
227 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12018922 |
aaaacatatatttacgatatttttatagtaagagaaaaaataaagtcaaattgtttttttataagctataaactgttttcataagtattgttatcttatg |
12018823 |
T |
 |
| Q |
228 |
ttgcttaattacttgctttgcaccgcaccctttttctcatcatcttg |
274 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12018822 |
ttgc----ttacttgctttgcaccgcactctttttctcatcatcttg |
12018780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University