View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1948_high_17 (Length: 241)
Name: NF1948_high_17
Description: NF1948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1948_high_17 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 31943218 - 31942978
Alignment:
| Q |
1 |
agcacagactccatggatgatggcagaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttcttctaatgggattgcta |
100 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31943218 |
agcatagactccatggattctggtagaggtccacccaaaaggattagaggaaatcaccaatctcctagtacattggcaagttcttttaatgggattgcta |
31943119 |
T |
 |
| Q |
101 |
tgagggataatgcaacattgttatctcaaattcatttgctggatcaagtaggacaacttggtaattcatggagcaggttcagtcaatcaattatggtgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
31943118 |
tgagggataatgcaacattgttatctcaaattcacttgctcgatcaagtaggacaacttggtaattcatggagaaggcccggtcaatcaattatggtgaa |
31943019 |
T |
 |
| Q |
201 |
taacggtaataaccatttagttcctgcaaataatttggtgc |
241 |
Q |
| |
|
||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
31943018 |
taacggtaatagccatttagttcctgaaaacaatttggtgc |
31942978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 31952404 - 31952227
Alignment:
| Q |
8 |
actccatggatgatggcagaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttctt------------ctaatgggat |
95 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| | | | |
|
|
| T |
31952404 |
actcaatggatgatggtagaggtccacccaaaagaattagaggaaatcaccaatctcctaatacattggcaagttcttctatttctccccctaacgaggt |
31952305 |
T |
 |
| Q |
96 |
tgctatgagggataatgcaacattgttatctcaaattcatttgctggatcaagtaggacaacttggtaattcatggag |
173 |
Q |
| |
|
||||||| ||| ||||| ||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
31952304 |
tgctatggggggtaatgtaacattgccatctcaaattcatttgctcaatcaagtagaacaacttggtaattcatggag |
31952227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University