View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1948_low_23 (Length: 226)
Name: NF1948_low_23
Description: NF1948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1948_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 59 - 213
Target Start/End: Complemental strand, 6822774 - 6822620
Alignment:
| Q |
59 |
aaagtctttcctctaattttccatacaaccagagggatgaaagcttctccaactttgacatattaatcgatataagtttatcaggatcaccagcttcatc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6822774 |
aaagtctttcctctaattttccatacaaccggagggatgaaagcttctccaactttgacatattaatcgatataagtttatcaggatcgccagcttcatc |
6822675 |
T |
|
| Q |
159 |
cacggatttaagtgacagtgaatgaagctgttcaaggttcacaatcttctgtgct |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6822674 |
cacggatttaagtgacaatgaatgaagctgttcaaggttcacaatcttctgtgct |
6822620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 70 - 208
Target Start/End: Complemental strand, 7335054 - 7334916
Alignment:
| Q |
70 |
tctaattttccatacaaccagagggatgaaagcttctccaactttgacatattaatcgatataagtttatcaggatcaccagcttcatccacggatttaa |
169 |
Q |
| |
|
|||||||| ||| |||| | |||||| || || || |||| |||||||||||||||| || ||||||| | ||||||||||| ||||||||| ||||| | |
|
|
| T |
7335054 |
tctaatttgccaaacaaacggagggacgagagattatccagctttgacatattaatccatttaagttttttaggatcaccagtttcatccactgatttga |
7334955 |
T |
|
| Q |
170 |
gtgacagtgaatgaagctgttcaaggttcacaatcttct |
208 |
Q |
| |
|
||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
7334954 |
gtgtcagtgaatgaagttgttcaagcttcacaatcttct |
7334916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University